Steven Avery
Administrator
"Coronaviruses are enveloped, positive-stranded RNA viruses with a genome of approximately 30 kb"
www.ncbi.nlm.nih.gov
"Human genomes are over 3 billion base letters long. ...Coronaviruses are RNA viruses and the newly-discovered virus SARS-CoV-2 has a single short RNA strand that is just 30,000 letters long."
https://coronavirusexplained.ukri.org/en/article/und0001/
Complete Genomic Sequence of Human Coronavirus OC43: Molecular Clock Analysis Suggests a Relatively Recent Zoonotic Coronavirus Transmission Event - PMC
Coronaviruses are enveloped, positive-stranded RNA viruses with a genome of approximately 30 kb. Based on genetic similarities, coronaviruses are classified into three groups. Two group 2 coronaviruses, human coronavirus OC43 (HCoV-OC43) and bovine ...
"Human genomes are over 3 billion base letters long. ...Coronaviruses are RNA viruses and the newly-discovered virus SARS-CoV-2 has a single short RNA strand that is just 30,000 letters long."
https://coronavirusexplained.ukri.org/en/article/und0001/
https://arxiv.org/ftp/arxiv/papers/1502/1502.03732.pdfViruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome. ... Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.
The first sequence of RNA letters reads:
auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag
This sequence recruits machinery inside the infected cell to read the RNA letters — a, c, g and u — and translate them into coronavirus proteins.
https://www.nytimes.com/interactive...virus-genome-bad-news-wrapped-in-protein.html
Last edited: